Orphelia [Help]

Model

Orphelia currently provides two models for scoring open reading frames in sequence fragments, Net700 and Net300. In order to run the webserver, you need to specify, which model should be used to predict genes in your input data.

Below sensitivity and specificity for both models in the range of 200 to 500 bp is provided. Click on the figures to get a fullscreen view.

       

Max overlap

The user may define the maximal overlap between two predicted genes. If the maximal overlap is e.g. 60, no genes will be predicted that overlap more than 60 bp. A more conservative overlap parameter, e.g. 0, will lead to the prediction of fewer genes, while the permission of a larger overlap, e.g. 400 bp, may lead to overprediction. See a length histogram of overlapping genes in the Orphelia training species (x-axis: number of overlapping base pairs, y-axis: absolut frequency``).

Input Formats

Input file in multiple FASTA:

> Seq No 1
CCTCCTCCTGTTTTTCCCTCAATACAACCTCATTGGATTATTCAATTCAC
CATCCTGCCCTTGTTCCTTCCATTATACAGCTGTCTTTGCCCTCTCCTTC
TCTCGCTGGACTGTTCACCAACTCTCAGCCCGCGATCCCAATTTCCAGAC
AACCCATCTTATCAGCTTGGCCACGGCCTCGACCCGAACAGACCGGCGTC
CAGCGAGAAGAGCGTCGCCTCGACGCCTCTGCTTGACCGCACCTTGATGC
TCAAGACTTATCGCGATGCCAAGAAGCGTCTCATCATGTTCGACTACGA
> Seq No 2
CGAAACGGGCACCTATACAACGATTGAAACCATTATTCAAGCTCAGCAAG
CGTCTATGCTAGCGGTTATTGCGAGCACTTCAGCGGTTGCTACTACGACT
ACTACTTGATAAATGAAACGGCTATAAAAGAGGCTGGGGCAAAAGTATGT
TAGTTGAAGGGTGACCTGAACGATGAATCGGTCGAATTTTTTATTGGCAG
AGGGAAGGTAGGTTTACTCAATTTAGTTACTTCTAGCCGTTGATTGGAGG
AGCGCAAGCGACGAGGAGGCTCATCGGCCGCCCGCGGAAAGCGTAGTCT
TACACGGAAATCAACGGCGGTGTCATAAGCGAG
> Seq No 3
.....

Output Formats

The results are send via Email.

  1. gene.pred : The final prediction in coord format
  2. >FragmentNo,ORFinFragNo_posleft_posRight_+|-_Frame_C|I_FragHeader
    


Please direct your questions and comments to orphelia-info@gobics.de.